…aquí, también se cuecen habas (tengo de todo)

Tengo unos vecinos, pegados a mi ventana, cuyo perro empieza a ladrar a las 7:30 de la mañana a todo aquello que se mueva delante de su puerta, esto viene a ser: ladridos intermitentes, cada quince minutos hasta aproximadamente las 11:30. Y me acuerdo, cada vez que ladra, de una tortura china que me contaron en mis clases de Psicología (que abandoné antes de acabar el primer año) sobre como los chinos, en tiempos de guerra, dejaban que el prisionero se durmiera para despertarlo poco después y que se volviera a dormir de nuevo, para volver a despertarlo…hasta el infinito. Hasta que el prisionero se volvía loco.

Tengo una abuela que llama desde la otra punta del país para llorar por teléfono y para quejarse de la mala vida que no ha tenido, pero que ella cree que sí. Y hoy llora porque se ha quemado el negocio de mi tío. Y esta llamada no tiene otro fin que el de reclamar ayuda humanitaria. Y yo me enfado, mucho, por que la tomadura de pelo ya es suprema.

Tengo un vecino que pone la televisión tan alta que no me queda otro remedio que cerrar las ventanas si quiero oír la mía, bajo el riesgo de morir deshidratada en la sauna que es estos días mi casa. Al fin apaga la televisión y puedo oír yo la mía, corro a abrir las ventanas justo al tiempo que él agarra un martillo hidráulico; y vuelvo al sofá, abatida y sudorosa. Y con las ventanas cerradas.

Tengo un café con Teks, hasta que a última hora me lo cancela porque le ha picado no sé sabe qué en el tobillo y se le ha hinchado tanto que, a estas horas, ya parece un melón. Y entonces ya no tengo más remedio que quedarme en casa, adherida, literalmente, al sofá en estado semi-vegetativo, enterándome de quién es la nueva novia de Paquirrín o de si María Teresa Campos y su hija se han echado novio a la vez; que no es el mismo, deduzco.

Tengo la suerte de que Wap me acoje en su casa cada miércoles, donde no hay perros, ni abuelas que lloran, ni televisores a todo trapo; donde todo, al explicarlo, se distancia y cobra otra dimensión…

21 comentarios

Archivado bajo Amigos, Familia, Life, Personal, Reflexiones

21 Respuestas a “…aquí, también se cuecen habas (tengo de todo)

  1. con calma, que te va a dar un algo😛

  2. jajaja…un algo..sísí, ya estoy más calmada, Red

  3. I love my job, I love my job, I love my job, I love my job, I love my job, I love my job, I love my job, I love my job, I love it sooooo much that I can spent a whole afternoon translating spanish websites😉

    Xx

    PS: Waking up, sun shines in your face. You walk out in your shirt, and the sun still shines. You enter the subway: sunny, sunny, sunny. You exit the subway: raining cats and dogs (unfortunately not the dog from your story ;-)).

  4. I’m really happy u enjoy ur job that much, Sebas!…actually it is boiling-hot-sunny in here, let’s see if it keeps on like this when I get to Bcn… can’t stand this heat anymore!

  5. ERU

    Ay los perritos… qué monos son cuando no ladran, ni muerden, ni arañan, ni babean, ni ensucian, ni tiran cosas…

  6. “Qué tengo, qué tengo, qué tengo de tó…” Hija de mi vida, que stress…;)
    Pd: Mis vecinos también son un encanto, un día te hablo de ellos, para que el mal de dos se convierta en consuelo de desesperadas ojerosas que sólo ansían dormir cuatro horas seguidas…
    Pd2: No veas como se lo curran los chinos en cuestión de torturas, la de Shakira a su lado es una bendición, por Dios!😛

  7. Pues sí, Eru, son la mar de monos…lástima que la mayoría del tiempo hagan algo de lo que tú dices…

    De tó tengo, Sunshine!! Háblame de tus vecinos, consuélame un poquito…se marcan zapateaos a las tantas de la madrugada? se les ocurre cambiar los muebles de sitio a horas intempestivas? A los de encima de mis abuelos, sí!

  8. dokomho

    Pues yo no se si son los vecinos o que yo soy un poco neurótico… pero es normal oír caer como una canica todos los días a las 12 de la noche??? estoy empezando a pensar que lo hacen a posta.

    En fin con subir la música de los auriculares a veces se solucionan estos “pequeños” conflictos…

    O eso o te compras una escopeta y practicas tiro con el perro…😛

  9. Una canicaaa? Jajajaja, Dokomho, qué mala pata de vecinos! jajaja Aix, pobre perro, nunca le haría daño, aunque a veces me dan ganas de sacar la cabeza por la ventana y pegarle cuatro gritos…al perro, sí…creo que sería contraproducente, igual…😦

  10. dokomho

    bueno siempre puedes denunciar… que está muy de moda ultimamente

    Y con eso de los decibelios seguro que ganas

  11. Wenass!!!
    Tenía una vecina en el piso donde vivimos mis padres y yo que si te ocurría tender la ropa a partir de las 11 de la noche y les caía una gota de agua o suavizante en su toldo, y lo oían/olían/veían, subía y te tiraba un cubo de agua (de agua sucia) al felpudo…cómo te lo cuento muy fuerrte. Yo creo que fregaba una vez a la semana y se esperaba a la gota de los sábados para vaciar…
    Ayy lo de la canica me suena, en donde vivía antes, oía esa canica a una hora exacta de la madrugada… soñaba con ella al final.
    Estuve a punto de llamar a los de Cuarto Milenio para ver sí hacían unas cuántas psicofonías en mi casa, y sobretodo en la de arriba (no vivía nadie, que yuyu)
    PD: Eso, o servía de picadero (o vete a saber para qué) de uvas a peras a los herederos del piso.
    Saluditos!!!

  12. dokomho

    En mi caso no tiene nada de paranormal… simplemente que hay mucho Hdp suelto

  13. ¿A vosotros también os pasa lo de la canica??😯
    Debe ser como el balón de Nivea, que sólo hay uno y se lo van pasando los muy sjdhsakjgd👿
    Definitivamente, los vecinos (no) se merecen un post.
    Pd: Cagüentólascanicasdelmundomundial :I

  14. Pingback: Dear Neighbours… « A la Luna se le ve el Ombligo

  15. Teksait

    Pues yo a veces hecho en falta estos momentos… por ejemplo, ayer, con el tobillo jodido, tirado en casa, to solo… y ni un solo ruido; ni vecinos, ni perros, ni canicas ni na de na… y yo allí, intentando dormir sin poder pq el silencio me ponía nerviosooo…

    Anyway… que el coffee está pendiente, ok? Pásame un poco de estrés y así nos compensamos😉

  16. Bueno Kafka, lo de la mujer con el cubo de agua sucia tiene delito…hay mucho amargao suelto! En Japón qué tal los vecinos?!

    Jajaja, Sunshine! Te veo fina con las canicas a tí también! jajaja Voy ahora mismo a ver ese post de los queridos neighbours…

    Ai Teks, es que tienes muy mala pata, tú… (te has quedado con el doble sentido? jurjur😉 ) Vale..ha sido muy malo este… Coffee+traspaso de stress en breve, dont’ worry!

  17. r0sa

    o_O
    Uala . . . que a mí lo de la canica también me pasa!! Y el ruído de subir persianas y de subir escaleras!!
    Que fort. . .xD

  18. Todos tenemos los mismo vecinos, rOsa! jejej😉

  19. Pues debe ser eso MiLi, porque yo sigo alucinando con lo de las canicas…😯
    Estoy convencida de que hay una conspiración para sacarnos de quicio con el dichoso ruidito tactactactactactactactac😐

  20. mariquilla

    despues de leerme tu blog entero he deducido,que mi vida es una mierda,y la tuya esta guay jajaj¡¡¡¡
    a mi me pasa lo mismo que a ti con wap cuando vas a su casa,hay gente que hace que el tiempo se pare

  21. Entero?! Jajaja, qué va, Mariquilla, no es tan guaay..será la forma de contarlo😛

Responder

Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de WordPress.com

Estás comentando usando tu cuenta de WordPress.com. Cerrar sesión / Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión / Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión / Cambiar )

Google+ photo

Estás comentando usando tu cuenta de Google+. Cerrar sesión / Cambiar )

Conectando a %s